منافسة عامة قيد التنفيذ

طلبات معامل كلية العلوم الطبية التطبيقية بجامعة الحدود الشمالية

جامعة الحدود الشمالية

رقم المنافسة

220339534898

المعرّف

#385519

رقم المنافسة
220339534898
رقم المنافسة الداخلي
—
الجهة الحكومية
جامعة الحدود الشمالية
الفرع / الإدارة
التأمين المباشر
نوع المنافسة
منافسة عامة
حالة المنافسة
—
طريقة تقديم العروض
—
رسوم الاشتراك
500 ر.س
سعر كراسة الاشتراط
500 ر.س
تكلفة الدعوة
200 ر.س
تكلفة الشراء
500 ر.س
الضمان الإبتدائي
—
الضمان النهائي
—
مدة العقد
—
التأمين مطلوب
—
مدة الوقفة (أيام)
—
داخل المملكة
—
التاريخ ميلادي هجري
تاريخ النشر 2022/04/13 14:46 —
آخر موعد للاستفسارات 2022/04/25 1443-09-24
آخر موعد تقديم العروض 2022/05/10 09:30 1443-10-09
موعد فتح العروض 2022/05/10 10:10 1443-10-09
موعد فحص العروض — —
التاريخ المتوقع للترسية — —
تاريخ بدء الأعمال — —
تاريخ خطاب تأكيد المشاركة — —
بداية إرسال الأسئلة — —

موقع التنفيذ

منطقة التنفيذ
—
مدن التنفيذ
—

مجال التصنيف

يشمل مواد توريد
لا

جدول 1 المواد - توريد عام

البند الفئة الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
Proteinase K مواد كيميائية 600 Proteinase K Proteinase K mg 1 0
SYBR Green Supermix مواد كيميائية 2 SYBR Green Supermix iQ™ SYBR® Green Supermix, 500 x 50 µl rxns, 12.5 ml (10x1.25 ml) (BioRad) Kit 2 0
GoTaq PCR Core System I مواد كيميائية 2 GoTaq PCR Core System I GoTaq® PCR Core System I (Promega) kit 3 0
FlexiGene DNA Kit مواد كيميائية 2 FlexiGene DNA Kit FlexiGene DNA Kit (250) (Qiagen) kit 4 0
SYBR Green I nucleic acid gel stain مواد كيميائية 10 SYBR Green I nucleic acid gel stain SYBR® Green I nucleic acid gel stain (MERCK) ml 5 0
100 pb DNA Ladder مواد كيميائية 2 100 pb DNA Ladder 100 pb DNA Ladder (250 μl) ml 6 0
Forward primer مواد كيميائية 2 Forward primer Forward primer 5' CAACTTCATCCACGTTCACC 3' (25 nmol) tube 7 0
Reverse primer مواد كيميائية 2 Reverse primer Reverse primer 5' ACACAACTGTGTTCACTAGC 3' (25 nmol) tube 8 0

8 بند

جدول 2 المواد - توريد عام

البند الفئة الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
ABO antisera Anti A B AB D مواد كيميائية 40 ABO antisera Anti A B AB D ABO antisera Anti A, B, AB, D Kit 1 0
Anti A1 مواد كيميائية 10 Anti A1 Anti A1 Vial 2 0
Anti K مواد كيميائية 10 Anti K Anti K Vial 3 0
Anti k مواد كيميائية 10 Anti k Anti k Vial 4 0
Anti Fya and Fyb مواد كيميائية 10 Anti Fya and Fyb Anti Fya & Fyb Vial 5 0
Anti Lea and Leb مواد كيميائية 10 Anti Lea and Leb Anti Lea &Leb Vial 6 0
Anti Lua and Lub مواد كيميائية 10 Anti Lua and Lub Anti Lua &Lub Vial 7 0
Anti C مواد كيميائية 10 Anti C Anti C Vial 8 0
Anti c مواد كيميائية 10 Anti c Anti c Vial 9 0
Anti E مواد كيميائية 10 Anti E Anti E Vial 10 0
Anti e مواد كيميائية 10 Anti e Anti e Vial 11 0
antihuman globulin مواد كيميائية 30 antihuman globulin antihuman globulin Vial 12 0
bovine albumin مواد كيميائية 16 bovine albumin bovine albumin Vial 13 0
normal saline مواد كيميائية 20 normal saline normal saline bottle 14 0
set of panel cell مواد كيميائية 5 set of panel cell set of panel cell kit 15 0
Pasteur pipette مواد كيميائية 8 Pasteur pipette Pasteur pipette Box 16 0
Small test tube مواد كيميائية 10 Small test tube Small test tube Box 17 0

17 بند

جدول 3 المواد - توريد عام

البند الفئة الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
Glacial acetic acid مواد كيميائية 2 Glacial acetic acid L 1 0
Sodium oxalate مواد كيميائية 5 Sodium oxalate L 2 0
Drabkins solution مواد كيميائية 20 Drabkins solution Kit 3 0
Prothrombin مواد كيميائية 20 Prothrombin Kit 4 0
Thrombin time solution مواد كيميائية 10 Thrombin time solution Kit 5 0
Partial thromboplastin time PTT مواد كيميائية 20 Partial thromboplastin time PTT Kit 6 0
Calcium chloride مواد كيميائية 20 Calcium chloride Kit 7 0
Gemisa stain مواد كيميائية 2 Gemisa stain L 8 0
Leishman stain مواد كيميائية 6 Leishman stain L 9 0
New methylene blue مواد كيميائية 2 New methylene blue L 10 0
Brilliant cresyl blue مواد كيميائية 1 Brilliant cresyl blue L 11 0
Vacutainer tube EDTA مواد كيميائية 6 Vacutainer tube EDTA Cartone 12 0
Vacutainer tubes sodium citrate مواد كيميائية 4 Vacutainer tubes sodium citrate Cartone 13 0
Alcohol swab مواد كيميائية 100 Alcohol swab Box 14 0
Immersion oil for microscopes مواد كيميائية 500 Immersion oil for microscopes Ml 15 0
Ethyl alcohol مواد كيميائية 2 Ethyl alcohol L 16 0
Diluent for sysmex مواد كيميائية 5 Diluent for sysmex Cartone 17 0
Westergreen tubes مواد كيميائية 10 Westergreen tubes Cartone 18 0
Cell pack for sysmex مواد كيميائية 5 Cell pack for sysmex Cartone 19 0
Methyl alcohol مواد كيميائية 2 Methyl alcohol L 20 0
Pasteur pipette مواد كيميائية 10 Pasteur pipette Cartone 21 0
Staining raks مواد كيميائية 30 Staining raks Rak 22 0
Lancet مواد كيميائية 10 Lancet Box 23 0
Microscopic slides مواد كيميائية 50 Microscopic slides Box 24 0
Masks مواد كيميائية 8 Masks Box 25 0
Cover glass مواد كيميائية 50 Cover glass Box 26 0
Small test tubes مواد كيميائية 10 Small test tubes Box 27 0
Gloves مواد كيميائية 200 Gloves Box 28 0
Filter paper مواد كيميائية 20 Filter paper Box 29 0
Hemocytometer مواد كيميائية 30 Hemocytometer Peice 30 0
Wax مواد كيميائية 5 Wax Bottle 31 0
Sodium metabisulphate مواد كيميائية 300 Sodium metabisulphate g 32 0
Gauze مواد كيميائية 100 Gauze Mete 33 0
Stop watch مواد كيميائية 10 Stop watch Peice 34 0
Capillary tube مواد كيميائية 20 Capillary tube Box 35 0
cytochemical stains مواد كيميائية 2 cytochemical stains cytochemical stain…sudan black,,myeloperoxidase,,,PAS,,nonspecific esterase,,,Acid phosphatase and leukocyte alkaline phosphatases Kit 36 0

36 بند

جدول 4 المواد - توريد عام

البند الفئة الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
CRP Latex Agglutination kit مواد كيميائية 8 CRP Latex Agglutination kit CRP Latex Agglutination kit kit 1 0
RF Latex Agglutination kit مواد كيميائية 8 RF Latex Agglutination kit RF Latex Agglutination kit kit 2 0
ASO Latex Agglutination kit مواد كيميائية 8 ASO Latex Agglutination kit ASO Latex Agglutination kit kit 3 0
Rapid Plasma Reagin kit مواد كيميائية 8 Rapid Plasma Reagin kit RPR (Rapid Plasma Reagin) kit kit 4 0
Widal test teaching kit for typhoid مواد كيميائية 8 Widal test teaching kit for typhoid Widal test teaching kit for typhoid kit 5 0
Febrile Antigen kit for brucella مواد كيميائية 8 Febrile Antigen kit for brucella Febrile Antigen kit for brucella kit 6 0
TPHA kit for syphilis مواد كيميائية 4 TPHA kit for syphilis TPHA kit for syphilis kit 7 0
Single radial immunodiffusion teaching kit مواد كيميائية 8 Single radial immunodiffusion teaching kit Single radial immunodiffusion teaching kit kit 8 0
Ouchterlony double diffusion teaching kit مواد كيميائية 8 Ouchterlony double diffusion teaching kit Ouchterlony double diffusion teaching kit kit 9 0
Immunoelectrophoresis teaching kit مواد كيميائية 8 Immunoelectrophoresis teaching kit Immunoelectrophoresis teaching kit kit 10 0
ANA Western blot test kit مواد كيميائية 8 ANA Western blot test kit ANA Western blot test kit kit 11 0
ANA Immunoflourescence test kit مواد كيميائية 8 ANA Immunoflourescence test kit ANA Immunoflourescence test kit kit 12 0
Allergy Skin prick test kit مواد كيميائية 8 Allergy Skin prick test kit Allergy Skin prick test kit kit 13 0
Allergy skin patch test مواد كيميائية 8 Allergy skin patch test Allergy skin patch test kit 14 0
Tuberculin skin test kit مواد كيميائية 8 Tuberculin skin test kit Tuberculin skin test kit kit 15 0
CH 50 test kit مواد كيميائية 8 CH 50 test kit CH 50 test kit kit 16 0
Coombs reagent مواد كيميائية 8 Coombs reagent Coombs reagent kit 17 0
Paul Bunnell test kit مواد كيميائية 8 Paul Bunnell test kit Paul Bunnell test kit kit 18 0
Weil Felix test kit مواد كيميائية 8 Weil Felix test kit Weil Felix test kit kit 19 0
Herpes simples virus type1 IgG antibodies Elisa kit مواد كيميائية 4 Herpes simples virus type1 IgG antibodies Elisa kit Herpes simples virus type1 IgG antibodies Elisa kit kit 20 0
ICT pregnancy test مواد كيميائية 2 ICT pregnancy test ICT pregnancy test box 21 0
Gram Stain Kit مواد كيميائية 8 Gram Stain Kit Gram Stain Kit kit 22 0
Z N Stain Kit مواد كيميائية 8 Z N Stain Kit Z-N Stain Kit kit 23 0
API 20E مواد كيميائية 300 API 20E API 20E / (BioMerieux) devise 24 0
Oxidase Reagent مواد كيميائية 400 Oxidase Reagent Oxidase Reagent (100ml) ml 25 0
L J Media tubes slants مواد كيميائية 50 L J Media tubes slants L J Media tubes slants tube 26 0
Mineral oil مواد كيميائية 100 Mineral oil Mineral oil ml 27 0
AFB Slide مواد كيميائية 100 AFB Slide AFB Slide slide 28 0
Urine antibiotic disc rings مواد كيميائية 4 Urine antibiotic disc rings Urine antibiotic disc rings ring 29 0
Lactophenol cotton blue stain مواد كيميائية 500 Lactophenol cotton blue stain Lactophenol cotton blue stain ml 30 0
Bacitracin مواد كيميائية 4 Bacitracin Bacitracin 0.04 units - 5*50 tests catridge 31 0
Novobiocin مواد كيميائية 4 Novobiocin Novobiocin 30µg disk- 5*50 tests catridge 32 0
Optochin disc مواد كيميائية 4 Optochin disc Optochin disc catridge 33 0
Latex kit Slidex Strepto مواد كيميائية 8 Latex kit Slidex Strepto Latex kit Slidex® Strepto kit 34 0
Albert stain kit مواد كيميائية 6 Albert stain kit Albert stain kit kit 35 0
Schaeffer and Fultions Spore stain kit مواد كيميائية 6 Schaeffer and Fultions Spore stain kit Schaeffer & Fultions Spore stain kit kit 36 0
Liefson Bacterial Falgella Stain kit مواد كيميائية 6 Liefson Bacterial Falgella Stain kit Liefson Bacterial Falgella Stain kit kit 37 0

37 بند

جدول 5 المواد - توريد عام

البند الفئة الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
Urine test strips مواد كيميائية 10 Urine test strips Urine test strips bottles 1 0
Alpha naphthol مواد كيميائية 500 Alpha naphthol Alpha naphthol gm 2 0
Glucose estimation kit مواد كيميائية 3 Glucose estimation kit Glucose estimation kit L 3 0
Iodine solution مواد كيميائية 500 Iodine solution Iodine solution ml 4 0
Albumin estimation kit مواد كيميائية 3 Albumin estimation kit Albumin estimation kit L 5 0
Sodium hydrogen sulphate مواد كيميائية 500 Sodium hydrogen sulphate Sodium hydrogen sulphate gm 6 0
Buffer solutions different pH مواد كيميائية 6 Buffer solutions different pH Buffer solutions pH 7/4/10 Tube 7 0
Creatinine kits مواد كيميائية 2 Creatinine kits Creatinine kits L 8 0
Copper sulphate مواد كيميائية 500 Copper sulphate Copper sulphate gm 9 0
Sodium carbonatel bicarbonate مواد كيميائية 500 Sodium carbonatel bicarbonate Sodium carbonatel bicarbonate gm 10 0
Sodium dehydrogenase phosphate مواد كيميائية 500 Sodium dehydrogenase phosphate Sodium dehydrogenase phosphate gm 11 0
Albomin مواد كيميائية 500 Albomin Albomin gm 12 0
total plasma proteins kits مواد كيميائية 3 total plasma proteins kits total plasma proteins kits L 13 0
Tryptophan مواد كيميائية 250 Tryptophan Tryptophan gm 14 0

14 بند

جدول 6 المواد - توريد عام

البند الفئة الكمية وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
Diastase مواد كيميائية 1 Diastase Diastase ديستيس gm 1 0
Ethanol مواد كيميائية 80 Ethanol Ethanol ايثانول L 2 0
Methanol مواد كيميائية 80 Methanol Methanol ميثانول L 3 0
Mounting media مواد كيميائية 4 Mounting media Mounting media (DPX) ماونتينق ميديا L 4 0
Schiffs reagent مواد كيميائية 4 Schiffs reagent Schiff’s reagent اسشف ريئجنت L 5 0
Harris heamatoxylin stain ready use مواد كيميائية 10 Harris heamatoxylin stain ready use Harri's heamatoxylin stain ready use هرز هيماتوكسلين جاهز L 6 0
Mayers heamatoxylin stain ready use مواد كيميائية 10 Mayers heamatoxylin stain ready use Mayer's heamatoxylin stain ready useميرز هيماتوكسلين جاهز L 7 0
Crystal violet stain ready use مواد كيميائية 4 Crystal violet stain ready use Crystal violet stain ready use كريستل فيولت جاهز Kit 8 0
Trichroms stain ready use مواد كيميائية 4 Trichroms stain ready use Trichrom's stain ready use ترايكروم صبغة جاهز Kit 9 0
Alcian blue stain ready use مواد كيميائية 4 Alcian blue stain ready use Alcian blue stain pH 2.5 ready use صبغة الشين بلو2.5 Kit 10 0
Alcian blue stain ready use مواد كيميائية 2 Alcian blue stain ready use Alcian blue stain pH 3.2 ready use 3.2 صبغة الشين بلو Kit 11 0
Alcian blue stain ready use مواد كيميائية 2 Alcian blue stain ready use Alcian blue stain pH 0.1 ready use0.1 صبغة الشين بلو Kit 12 0
Van Giesons stain ready use مواد كيميائية 4 Van Giesons stain ready use Van Gieson's stain ready use صبغة فانجنسون جاهزة Kit 13 0
Eosin ready use مواد كيميائية 2 Eosin ready use Eosin ready use ايوسين جاهز L 14 0
Giemsa stain ready use مواد كيميائية 2 Giemsa stain ready use Giemsa stain ready use صبغة جيمسا جاهزة Kit 15 0
Perls Prussion stain ready use مواد كيميائية 4 Perls Prussion stain ready use Perl's Prussion stain ready use صبغة بيرلزبرشن جاهزة Kit 16 0
Gordon and sweets Silver stain ready use مواد كيميائية 4 Gordon and sweets Silver stain ready use Gordon and sweet's Silver stain ready use صبغة قوردن وسويت سلفر جاهزة Kit 17 0
Sudan black stain ready use مواد كيميائية 4 Sudan black stain ready use Sudan black stain ready use صبغة سودان بلاك جاهزة Kit 18 0
Toluidine blue stain ready use مواد كيميائية 2 Toluidine blue stain ready use Toluidine blue stain ready use صبغة توليدين بلو جاهزة Kit 19 0
Van kossas stain ready use مواد كيميائية 4 Van kossas stain ready use Van kossa's stain ready use صبغة فانكوزا جاهزة Kit 20 0
Cango red stain ready use مواد كيميائية 4 Cango red stain ready use Cango red stain ready use صبغة كونقوريد جاهزة l 21 0
Orcien stain ready use مواد كيميائية 2 Orcien stain ready use Orcien stain ready use صبغة اورسين جاهزة l 22 0
Carmine stain ready use مواد كيميائية 2 Carmine stain ready use Carmine stain ready use صبغة كارمين جاهزة l 23 0
Orange G stain ready use مواد كيميائية 2 Orange G stain ready use Orange G stain ready use صبغة اورانج جى جاهزة l 24 0
Eosin azure 36 stain ready use مواد كيميائية 2 Eosin azure 36 stain ready use Eosin azure 36 stain ready use صبغة ايوسين ازور 36 l 25 0
Masson Fontana stain ready use مواد كيميائية 2 Masson Fontana stain ready use Masson Fontana stain ready use صبغة ماسون فونتانا جاهزة l 26 0
Xylene مواد كيميائية 20 Xylene Xylene زيالين L 27 0
Anhydrous copper sulphate مواد كيميائية 1 Anhydrous copper sulphate Anhydrous copper sulphate كبريتات النحاس اللامائية Kg 28 0

28 بند

جدول 7 المعدات والأجهزة - توريد عام

البند العدد الفئة وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
blue tips 2 أجهزة واداوات blue tips blue tips pack 1 0
Yellow tips 2 أجهزة واداوات Yellow tips Yellow tips pack 2 0
White tips 1 أجهزة واداوات White tips White tips pack 3 0
Latex gloves large size 50 أجهزة واداوات Latex gloves large size Latex gloves large size box 4 0
Hand santizer 4 أجهزة واداوات Hand santizer Hand santizer bottle 5 0
Micropipette 2 أجهزة واداوات Micropipette Micropipette size 0.1-5 μl pipette 6 0

6 بند

جدول 8 المعدات والأجهزة - توريد عام

البند العدد الفئة وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
microscope 10 أجهزة واداوات microscope microscope مايكروسكوب Pcs 1 0
Whatman filter paper 50 أجهزة واداوات Whatman filter paper Whatman filter paper وطمان ورق ترشيح box 2 0
Gloves medium size 50 أجهزة واداوات Gloves medium size Gloves medium size قفازات مقاس متوسط box 3 0
Gloves large size 50 أجهزة واداوات Gloves large size Gloves large size قفازات مقاس كبير box 4 0
Forceps 30 أجهزة واداوات Forceps Forceps Pcs 5 0
Face mask 50 أجهزة واداوات Face mask Face mask كمامات box 6 0
Pasteur pipette 10 أجهزة واداوات Pasteur pipette Pasteur pipette ماصة بلاستيكية box 7 0
Coplin jars 500 أجهزة واداوات Coplin jars Coplin jars كوبلن جار Pcs 8 0

8 بند

جدول 9 المعدات والأجهزة - توريد عام

البند العدد الفئة وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
Centrifuge 4 أجهزة و أدوات Centrifuge جهاز طرد مركزي Centrifuge item 1 0
Slides 20 أجهزة و أدوات Slides شرائح زجاجية Slides box 2 0
Cover glass 10 أجهزة و أدوات Cover glass غطاء زجاجي Cover glass box 3 0
centrifuge tubes 20 أجهزة و أدوات centrifuge tubes انابيب جهاز الطرد المركزي Centrifuge tubes box 4 0
Gloves 20 أجهزة و أدوات Gloves قفازا ت طبية Gloves box 5 0
Test tubes 10 أجهزة و أدوات Test tubes انابيب اختبار Test tubes box 6 0
Wooden stick 6 أجهزة و أدوات Wooden stick اعواد خشبية Wooden stick box 7 0
Capillary tubes 2 أجهزة و أدوات Capillary tubes انابيب شعيرية Capillary tubes box 8 0

8 بند

جدول 10 المعدات والأجهزة - توريد عام

البند العدد الفئة وصف البند المواصفات وحدة القياس الرقم التسلسلي منتج من القائمة الإلزامية
CRP Latex Agglutination kit 8 مواد كيميائية CRP Latex Agglutination kit CRP Latex Agglutination kit kit 1 0
RF Latex Agglutination kit 8 مواد كيميائية RF Latex Agglutination kit RF Latex Agglutination kit kit 2 0
ASO Latex Agglutination kit 8 مواد كيميائية ASO Latex Agglutination kit ASO Latex Agglutination kit kit 3 0
Rapid Plasma Reagin kit 8 مواد كيميائية Rapid Plasma Reagin kit RPR (Rapid Plasma Reagin) kit kit 4 0
Widal test teaching kit for typhoid 8 مواد كيميائية Widal test teaching kit for typhoid Widal test teaching kit for typhoid kit 5 0
Febrile Antigen kit for brucella 8 مواد كيميائية Febrile Antigen kit for brucella Febrile Antigen kit for brucella kit 6 0
TPHA kit for syphilis 4 مواد كيميائية TPHA kit for syphilis TPHA kit for syphilis kit 7 0
Single radial immunodiffusion teaching kit 8 مواد كيميائية Single radial immunodiffusion teaching kit Single radial immunodiffusion teaching kit kit 8 0
Ouchterlony double diffusion teaching kit 8 مواد كيميائية Ouchterlony double diffusion teaching kit Ouchterlony double diffusion teaching kit kit 9 0
Immunoelectrophoresis teaching kit 8 مواد كيميائية Immunoelectrophoresis teaching kit Immunoelectrophoresis teaching kit kit 10 0
ANA Western blot test kit 8 مواد كيميائية ANA Western blot test kit ANA Western blot test kit kit 11 0
ANA Immunoflourescence test kit 8 مواد كيميائية ANA Immunoflourescence test kit ANA Immunoflourescence test kit kit 12 0
Allergy Skin prick test kit 8 مواد كيميائية Allergy Skin prick test kit Allergy Skin prick test kit kit 13 0
Allergy skin patch test 8 مواد كيميائية Allergy skin patch test Allergy skin patch test kit 14 0
Tuberculin skin test kit 8 مواد كيميائية Tuberculin skin test kit Tuberculin skin test kit kit 15 0
CH 50 test kit 8 مواد كيميائية CH 50 test kit CH 50 test kit kit 16 0
Coombs reagent 8 مواد كيميائية Coombs reagent Coombs reagent kit 17 0
Paul Bunnell test kit 8 مواد كيميائية Paul Bunnell test kit Paul Bunnell test kit kit 18 0
Weil Felix test kit 8 مواد كيميائية Weil Felix test kit Weil Felix test kit kit 19 0
Herpes simples virus type1 IgG antibodies Elisa kit 4 مواد كيميائية Herpes simples virus type1 IgG antibodies Elisa kit Herpes simples virus type1 IgG antibodies Elisa kit kit 20 0
ICT pregnancy test 2 مواد كيميائية ICT pregnancy test ICT pregnancy test box 21 0
Gram Stain Kit 8 مواد كيميائية Gram Stain Kit Gram Stain Kit kit 22 0
Z N Stain Kit 8 مواد كيميائية Z N Stain Kit Z-N Stain Kit kit 23 0
API 20E 300 مواد كيميائية API 20E API 20E / (BioMerieux) devise 24 0
Oxidase Reagent 400 مواد كيميائية Oxidase Reagent Oxidase Reagent (100ml) ml 25 0
L J Media tubes slants 50 مواد كيميائية L J Media tubes slants L J Media tubes slants tube 26 0
Mineral oil 100 مواد كيميائية Mineral oil Mineral oil ml 27 0
AFB Slide 100 مواد كيميائية AFB Slide AFB Slide slide 28 0
Urine antibiotic disc rings 4 مواد كيميائية Urine antibiotic disc rings Urine antibiotic disc rings ring 29 0
Lactophenol cotton blue stain 500 مواد كيميائية Lactophenol cotton blue stain Lactophenol cotton blue stain ml 30 0
Bacitracin 4 مواد كيميائية Bacitracin Bacitracin 0.04 units - 5*50 tests catridge 31 0
Novobiocin 4 مواد كيميائية Novobiocin Novobiocin 30µg disk- 5*50 tests catridge 32 0
Optochin disc 4 مواد كيميائية Optochin disc Optochin disc catridge 33 0
Latex kit Slidex Strepto 8 مواد كيميائية Latex kit Slidex Strepto Latex kit Slidex® Strepto kit 34 0
Albert stain kit 6 مواد كيميائية Albert stain kit Albert stain kit kit 35 0
Schaeffer and Fultions Spore stain kit 6 مواد كيميائية Schaeffer and Fultions Spore stain kit Schaeffer & Fultions Spore stain kit kit 36 0
Liefson Bacterial Falgella Stain kit 6 مواد كيميائية Liefson Bacterial Falgella Stain kit Liefson Bacterial Falgella Stain kit kit 37 0

37 بند

كراسة الشروط الرئيسية

كراسة الشروط والمواصفات وملاحق المنافسة

1.3 MB تم التحميل

2022/385519/main_booklet_كراسة_الشروط.html

فتح

لم يتم ترسية هذه المنافسة بعد

لا توجد بيانات للمحتوى المحلي

معايير التقييم

لا توجد معايير تقييم

أخبار المنافسة

لا توجد أخبار